Review



human placenta cdna library  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    TaKaRa human placenta cdna library
    Human Placenta Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 430 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+placenta+cdna+library/Human+Placenta+QUICK-Clone+cDNA/pm40422215-46-4-8
    Average 93 stars, based on 430 article reviews
    human placenta cdna library - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Generation of Active Protease Depending on Peptide-Protein Interactions Using Interaction-Dependent Native Chemical Ligation and Protein Trans-Splicing
    Article Snippet: An artificial signal transduction system has been constructed by employing engineered human immunodeficiency type-1 (HIV-1) protease and Nostoc punctiforme PCC73102 (Npu) DnaE intein.. While the truncation of four amino acid residues at N-terminus of HIV-1 protease diminished its activity, the attachment of the PQIT sequence into the truncated protease by protein trans-splicing (PTS) reconstituted the enzymatic activity.. By combining interaction-dependent native chemical ligation (IDNCL) with the PTS reaction, the peptide-protein interaction was clearly detected by measuring HIV-1 protease activity.

    Article Title: FAM20B Gain-of-Function Blocks the Synthesis of Glycosaminoglycan Chains of Proteoglycans and Inhibits Proliferation and Migration of Glioblastoma Cells.
    Article Snippet: The Chinese hamster ovary cells (CHO-K1), CHO galactosyltransferase I deficient cell line pgsB-618, human embryonic kidney cells HEK293 (CRL-3216, ATCC, Manassas, VA, Cells 2025, 14, 712 3 of 21 USA), human brain tumor T98G (CRL-1690, ATCC), human lung adenocarcinoma cells A549 (CCL-185, ATCC, Manassas, VA, USA) and human primary skin fibroblasts were cultured in DMEM (4.5 mg/mL glucose) or DMEM-F12 medium supplemented with 2 mM glutamin, 100 IU/mL penicillin, 100 μg/mL streptomycin and 10% fetal bovine serum (FBS, Dutscher, Bernolsheim, France) at 37 ◦C with humidified atmosphere in a 5% CO2. .. FAM20B was amplified from human placenta cDNA library (Takara Bio, San Jose, CA, USA) by PCR using 5′GAATTCCACCATGAAGCTAAAGCAGCGAGTCGTG3′ (forward) including EcoRI site and 5′GGATCCTTACAAGTGTGAGAGAGCCATCCT3′ (reverse) primers including BamHI site, using Advantage GC 2 Polymerase Mix (Takara Bio). ..

    Article Title: FAM20B Gain-of-Function Blocks the Synthesis of Glycosaminoglycan Chains of Proteoglycans and Inhibits Proliferation and Migration of Glioblastoma Cells
    Article Snippet: The Chinese hamster ovary cells (CHO-K1), CHO galactosyltransferase I deficient cell line pgsB-618, human embryonic kidney cells HEK293 (CRL-3216, ATCC, Manassas, VA, USA), human brain tumor T98G (CRL-1690, ATCC), human lung adenocarcinoma cells A549 (CCL-185, ATCC, Manassas, VA, USA) and human primary skin fibroblasts were cultured in DMEM (4.5 mg/mL glucose) or DMEM-F12 medium supplemented with 2 mM glutamin, 100 IU/mL penicillin, 100 μg/mL streptomycin and 10% fetal bovine serum (FBS, Dutscher, Bernolsheim, France) at 37 °C with humidified atmosphere in a 5% CO 2 . .. FAM20B was amplified from human placenta cDNA library (Takara Bio, San Jose, CA, USA) by PCR using 5′GAATTCCACCATGAAGCTAAAGCAGCGAGTCGTG3′ (forward) including EcoRI site and 5′GGATCCTTACAAGTGTGAGAGAGCCATCCT3′ (reverse) primers including BamHI site, using Advantage GC 2 Polymerase Mix (Takara Bio). ..

    cDNA Library Assay:

    Article Title: Generation of Active Protease Depending on Peptide-Protein Interactions Using Interaction-Dependent Native Chemical Ligation and Protein Trans-Splicing
    Article Snippet: An artificial signal transduction system has been constructed by employing engineered human immunodeficiency type-1 (HIV-1) protease and Nostoc punctiforme PCC73102 (Npu) DnaE intein.. While the truncation of four amino acid residues at N-terminus of HIV-1 protease diminished its activity, the attachment of the PQIT sequence into the truncated protease by protein trans-splicing (PTS) reconstituted the enzymatic activity.. By combining interaction-dependent native chemical ligation (IDNCL) with the PTS reaction, the peptide-protein interaction was clearly detected by measuring HIV-1 protease activity.

    Article Title: FAM20B Gain-of-Function Blocks the Synthesis of Glycosaminoglycan Chains of Proteoglycans and Inhibits Proliferation and Migration of Glioblastoma Cells.
    Article Snippet: The Chinese hamster ovary cells (CHO-K1), CHO galactosyltransferase I deficient cell line pgsB-618, human embryonic kidney cells HEK293 (CRL-3216, ATCC, Manassas, VA, Cells 2025, 14, 712 3 of 21 USA), human brain tumor T98G (CRL-1690, ATCC), human lung adenocarcinoma cells A549 (CCL-185, ATCC, Manassas, VA, USA) and human primary skin fibroblasts were cultured in DMEM (4.5 mg/mL glucose) or DMEM-F12 medium supplemented with 2 mM glutamin, 100 IU/mL penicillin, 100 μg/mL streptomycin and 10% fetal bovine serum (FBS, Dutscher, Bernolsheim, France) at 37 ◦C with humidified atmosphere in a 5% CO2. .. FAM20B was amplified from human placenta cDNA library (Takara Bio, San Jose, CA, USA) by PCR using 5′GAATTCCACCATGAAGCTAAAGCAGCGAGTCGTG3′ (forward) including EcoRI site and 5′GGATCCTTACAAGTGTGAGAGAGCCATCCT3′ (reverse) primers including BamHI site, using Advantage GC 2 Polymerase Mix (Takara Bio). ..

    Article Title: Truncated Escherichia coli thioredoxin induces proliferation of human blood mononuclear cells and production of reactive oxygen species as well as proinflammatory cytokines.
    Article Snippet: Thioredoxin (Trx) is a redox protein characterized by a Trx fold.. A naturally occurring truncated human Trx, Trx 80, which lacks the Cterminal strand-helix of the Trx fold, stimulates proliferation of peripheral blood mononuclear cells (PBMCs).. It has not been clear how Trx80 gains this function.

    Article Title: Anti-human transferrin receptor antibody that passes through blood-brain barrier
    Article Snippet: .. Using a human placenta cDNA library (Takara Bio) as a template, nested PCR was performed with two primer sets, i.e., the outer primer set used in the first reaction: (a) I2S-f: (SEQ ID NO: 58) ACGCCTATTGCTGCAGGATG, and (b) I2S-r: (SEQ ID NO: 59) AAACGACCAGCTCTAACTCC, and the inner primer set used in the second reaction: (c) I2S-f2: (SEQ ID NO: 60) ATActcgagGCCACCATGCCGCCACCCCGG, and (d) 12S-r2: (SEQ ID NO: 61) TTCTTATgcggccgcTCAAGGCATCAACAA, to multiply a DNA fragment containing the cDNA encoding human iduronate-2-sulfatase (hI2S). ..

    Article Title: Medium containing uridine and N-acetyl-D-mannosamine
    Article Snippet: The hygromycin gene thus amplified was digested with SfiI and BstXI, and then inserted into the aforementioned pE-neo vector to form pE-hygr vector (FIG. 6). .. Using a human placenta cDNA library (Takara Bio Inc.) as a template, a primary PCR was performed with primer HCG-A-F (SEQ ID NO:7) and primer HCG-A-R (SEQ ID NO:8). ..

    Article Title: Medium containing uridine and N-acetyl-D-mannosamine
    Article Snippet: The hygromycin gene thus amplified was digested with SfiI and BstXI, and then inserted into the aforementioned pE-neo vector to form pE-hygr vector (FIG. 6). .. Using a human placenta cDNA library (Takara Bio Inc.) as a template, a primary PCR was performed with primer HCG-A-F (SEQ ID NO:7) and primer HCG-A-R (SEQ ID NO:8). ..

    Article Title: Impact of P-Glycoprotein on Intestinal Absorption of an Inhibitor of Apoptosis Protein Antagonist in Rats: Mechanisms of Nonlinear Pharmacokinetics and Food Effects.
    Article Snippet: Purpose This study was designed to investigate the effects of P-glycoprotein (P-gp) expressed in the intestine on the nonlinear pharmacokinetics (PK) of T-3256336, an inhibitor of apoptosis protein inhibitor, and food effects on its bioavailability in rats.. Methods To investigate the factors that contribute to nonlinear PK of T-3256336 in the intestine and liver, rats doublecannulated in the portal vein and femoral artery (PS rats) were used.. FaFg (Fa, absorption ratio; Fg, intestinal availability) and hepatic availability (Fh) were simultaneously evaluated based on the difference between the portal and systemic blood area under the concentration-time curve (AUC).

    Article Title: FAM20B Gain-of-Function Blocks the Synthesis of Glycosaminoglycan Chains of Proteoglycans and Inhibits Proliferation and Migration of Glioblastoma Cells
    Article Snippet: The Chinese hamster ovary cells (CHO-K1), CHO galactosyltransferase I deficient cell line pgsB-618, human embryonic kidney cells HEK293 (CRL-3216, ATCC, Manassas, VA, USA), human brain tumor T98G (CRL-1690, ATCC), human lung adenocarcinoma cells A549 (CCL-185, ATCC, Manassas, VA, USA) and human primary skin fibroblasts were cultured in DMEM (4.5 mg/mL glucose) or DMEM-F12 medium supplemented with 2 mM glutamin, 100 IU/mL penicillin, 100 μg/mL streptomycin and 10% fetal bovine serum (FBS, Dutscher, Bernolsheim, France) at 37 °C with humidified atmosphere in a 5% CO 2 . .. FAM20B was amplified from human placenta cDNA library (Takara Bio, San Jose, CA, USA) by PCR using 5′GAATTCCACCATGAAGCTAAAGCAGCGAGTCGTG3′ (forward) including EcoRI site and 5′GGATCCTTACAAGTGTGAGAGAGCCATCCT3′ (reverse) primers including BamHI site, using Advantage GC 2 Polymerase Mix (Takara Bio). ..

    Polymerase Chain Reaction:

    Article Title: Generation of Active Protease Depending on Peptide-Protein Interactions Using Interaction-Dependent Native Chemical Ligation and Protein Trans-Splicing
    Article Snippet: An artificial signal transduction system has been constructed by employing engineered human immunodeficiency type-1 (HIV-1) protease and Nostoc punctiforme PCC73102 (Npu) DnaE intein.. While the truncation of four amino acid residues at N-terminus of HIV-1 protease diminished its activity, the attachment of the PQIT sequence into the truncated protease by protein trans-splicing (PTS) reconstituted the enzymatic activity.. By combining interaction-dependent native chemical ligation (IDNCL) with the PTS reaction, the peptide-protein interaction was clearly detected by measuring HIV-1 protease activity.

    Article Title: FAM20B Gain-of-Function Blocks the Synthesis of Glycosaminoglycan Chains of Proteoglycans and Inhibits Proliferation and Migration of Glioblastoma Cells.
    Article Snippet: The Chinese hamster ovary cells (CHO-K1), CHO galactosyltransferase I deficient cell line pgsB-618, human embryonic kidney cells HEK293 (CRL-3216, ATCC, Manassas, VA, Cells 2025, 14, 712 3 of 21 USA), human brain tumor T98G (CRL-1690, ATCC), human lung adenocarcinoma cells A549 (CCL-185, ATCC, Manassas, VA, USA) and human primary skin fibroblasts were cultured in DMEM (4.5 mg/mL glucose) or DMEM-F12 medium supplemented with 2 mM glutamin, 100 IU/mL penicillin, 100 μg/mL streptomycin and 10% fetal bovine serum (FBS, Dutscher, Bernolsheim, France) at 37 ◦C with humidified atmosphere in a 5% CO2. .. FAM20B was amplified from human placenta cDNA library (Takara Bio, San Jose, CA, USA) by PCR using 5′GAATTCCACCATGAAGCTAAAGCAGCGAGTCGTG3′ (forward) including EcoRI site and 5′GGATCCTTACAAGTGTGAGAGAGCCATCCT3′ (reverse) primers including BamHI site, using Advantage GC 2 Polymerase Mix (Takara Bio). ..

    Article Title: Medium containing uridine and N-acetyl-D-mannosamine
    Article Snippet: The hygromycin gene thus amplified was digested with SfiI and BstXI, and then inserted into the aforementioned pE-neo vector to form pE-hygr vector (FIG. 6). .. Using a human placenta cDNA library (Takara Bio Inc.) as a template, a primary PCR was performed with primer HCG-A-F (SEQ ID NO:7) and primer HCG-A-R (SEQ ID NO:8). ..

    Article Title: Medium containing uridine and N-acetyl-D-mannosamine
    Article Snippet: The hygromycin gene thus amplified was digested with SfiI and BstXI, and then inserted into the aforementioned pE-neo vector to form pE-hygr vector (FIG. 6). .. Using a human placenta cDNA library (Takara Bio Inc.) as a template, a primary PCR was performed with primer HCG-A-F (SEQ ID NO:7) and primer HCG-A-R (SEQ ID NO:8). ..

    Article Title: FAM20B Gain-of-Function Blocks the Synthesis of Glycosaminoglycan Chains of Proteoglycans and Inhibits Proliferation and Migration of Glioblastoma Cells
    Article Snippet: The Chinese hamster ovary cells (CHO-K1), CHO galactosyltransferase I deficient cell line pgsB-618, human embryonic kidney cells HEK293 (CRL-3216, ATCC, Manassas, VA, USA), human brain tumor T98G (CRL-1690, ATCC), human lung adenocarcinoma cells A549 (CCL-185, ATCC, Manassas, VA, USA) and human primary skin fibroblasts were cultured in DMEM (4.5 mg/mL glucose) or DMEM-F12 medium supplemented with 2 mM glutamin, 100 IU/mL penicillin, 100 μg/mL streptomycin and 10% fetal bovine serum (FBS, Dutscher, Bernolsheim, France) at 37 °C with humidified atmosphere in a 5% CO 2 . .. FAM20B was amplified from human placenta cDNA library (Takara Bio, San Jose, CA, USA) by PCR using 5′GAATTCCACCATGAAGCTAAAGCAGCGAGTCGTG3′ (forward) including EcoRI site and 5′GGATCCTTACAAGTGTGAGAGAGCCATCCT3′ (reverse) primers including BamHI site, using Advantage GC 2 Polymerase Mix (Takara Bio). ..

    Clone Assay:

    Article Title: Truncated Escherichia coli thioredoxin induces proliferation of human blood mononuclear cells and production of reactive oxygen species as well as proinflammatory cytokines.
    Article Snippet: Thioredoxin (Trx) is a redox protein characterized by a Trx fold.. A naturally occurring truncated human Trx, Trx 80, which lacks the Cterminal strand-helix of the Trx fold, stimulates proliferation of peripheral blood mononuclear cells (PBMCs).. It has not been clear how Trx80 gains this function.

    Article Title: Impact of P-Glycoprotein on Intestinal Absorption of an Inhibitor of Apoptosis Protein Antagonist in Rats: Mechanisms of Nonlinear Pharmacokinetics and Food Effects.
    Article Snippet: Purpose This study was designed to investigate the effects of P-glycoprotein (P-gp) expressed in the intestine on the nonlinear pharmacokinetics (PK) of T-3256336, an inhibitor of apoptosis protein inhibitor, and food effects on its bioavailability in rats.. Methods To investigate the factors that contribute to nonlinear PK of T-3256336 in the intestine and liver, rats doublecannulated in the portal vein and femoral artery (PS rats) were used.. FaFg (Fa, absorption ratio; Fg, intestinal availability) and hepatic availability (Fh) were simultaneously evaluated based on the difference between the portal and systemic blood area under the concentration-time curve (AUC).

    Nested PCR:

    Article Title: Truncated Escherichia coli thioredoxin induces proliferation of human blood mononuclear cells and production of reactive oxygen species as well as proinflammatory cytokines.
    Article Snippet: Thioredoxin (Trx) is a redox protein characterized by a Trx fold.. A naturally occurring truncated human Trx, Trx 80, which lacks the Cterminal strand-helix of the Trx fold, stimulates proliferation of peripheral blood mononuclear cells (PBMCs).. It has not been clear how Trx80 gains this function.

    Article Title: Anti-human transferrin receptor antibody that passes through blood-brain barrier
    Article Snippet: .. Using a human placenta cDNA library (Takara Bio) as a template, nested PCR was performed with two primer sets, i.e., the outer primer set used in the first reaction: (a) I2S-f: (SEQ ID NO: 58) ACGCCTATTGCTGCAGGATG, and (b) I2S-r: (SEQ ID NO: 59) AAACGACCAGCTCTAACTCC, and the inner primer set used in the second reaction: (c) I2S-f2: (SEQ ID NO: 60) ATActcgagGCCACCATGCCGCCACCCCGG, and (d) 12S-r2: (SEQ ID NO: 61) TTCTTATgcggccgcTCAAGGCATCAACAA, to multiply a DNA fragment containing the cDNA encoding human iduronate-2-sulfatase (hI2S). ..



    Similar Products

    93
    TaKaRa human placenta cdna library
    Human Placenta Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+placenta+cdna+library/Human+Placenta+QUICK-Clone+cDNA/pm40422215-46-4-8
    Average 93 stars, based on 1 article reviews
    human placenta cdna library - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    TaKaRa human placenta cdna libraries
    Human Placenta Cdna Libraries, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+placenta+cdna+library/Human+Placenta+QUICK-Clone+cDNA/pm41086683-39-14-23
    Average 93 stars, based on 1 article reviews
    human placenta cdna libraries - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Zyagen Inc human placenta cdna library
    Human Placenta Cdna Library, supplied by Zyagen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+placenta+cdna+library/human+placenta+cdna+library/pm40531880-319-13-19
    Average 90 stars, based on 1 article reviews
    human placenta cdna library - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    TaKaRa human cdna placenta library
    Human Cdna Placenta Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+placenta+cdna+library/Human+Placenta+QUICK-Clone+cDNA/pmc11555324-252-11-15
    Average 93 stars, based on 1 article reviews
    human cdna placenta library - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    TaKaRa human placenta cdna library a
    Human Placenta Cdna Library A, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+placenta+cdna+library/Human+Placenta+QUICK-Clone+cDNA/us11649474-119-13-18
    Average 93 stars, based on 1 article reviews
    human placenta cdna library a - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Hybrigenics sa cdna human placenta library
    Cdna Human Placenta Library, supplied by Hybrigenics sa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+placenta+cdna+library/plasmids+derived+from+pgadgh+expressing+a+human+placenta+gene+bank/us11534452-1008-6-5
    Average 90 stars, based on 1 article reviews
    cdna human placenta library - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Hybrigenics sa human placenta cdna library
    Human Placenta Cdna Library, supplied by Hybrigenics sa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+placenta+cdna+library/plasmids+derived+from+pgadgh+expressing+a+human+placenta+gene+bank/pmc09763339-279-19-16
    Average 90 stars, based on 1 article reviews
    human placenta cdna library - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Becton Dickinson human placenta cdna library
    Human Placenta Cdna Library, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+placenta+cdna+library/human+placental+cdna+library/pmc01079803-215-9-13
    Average 90 stars, based on 1 article reviews
    human placenta cdna library - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    TaKaRa placental cdna library
    Placental Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+placenta+cdna+library/Human+Placenta+Marathon+-Ready+cDNA/pmc00420252-143-4-8
    Average 93 stars, based on 1 article reviews
    placental cdna library - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results